ORM2 protects against acute pancreatitis by inhibiting premature activation of pancreatic enzymes

Introduction

Acute pancreatitis (AP) is a common acute abdomen resulting from inflammation of the exocrine pancreas. Globally, its annual incidence ranges from 13 to 49 cases per 100,000 population—a figure steadily rising due to factors like obesity and gallstone disease, imposing a growing public health burden (1). Although AP is a common clinical emergency, current treatment remains to supportive care, as no therapies directly targeting its underlying pathogenesis exist (2). Indeed, mild AP can achieve complete spontaneous recovery within days to weeks, demonstrating the existence of endogenous protective mechanisms (2,3). However, our understanding of these mechanisms remains incomplete. Therefore, elucidating these self-repair processes is critical for developing novel targeted therapies to address unmet clinical needs.

Orosomucoid (ORM, also known as α1-acid glycoprotein or AGP) is an acute-phase protein with diverse biological functions, including immune regulation, drug carrier, and maintenance of capillary barrier (4). While primarily synthesized and secreted by the liver, recent studies have revealed that extrahepatic tissues also possess ORM-producing capacity (5-7), suggesting their potentially important physiological contributions. Emerging evidence has demonstrated its significant regulatory roles in various inflammatory diseases, including both hepatic (e.g., non-alcoholic steatohepatitis/NASH) (8,9) and extrahepatic (e.g., rheumatoid arthritis) disorders (10), as well as systemic metabolism-associated inflammatory responses (11). However, the role of ORM in AP, particularly in pancreatic tissue repair, remains unclear and deserves further investigation.

In this study, we observed opposing changes in ORM levels between liver and pancreas in AP- significantly increased in the liver while markedly decreased in the pancreas. Further investigations demonstrated that pancreas-specific ORM2 knockout exacerbated the severity of pancreatitis, whereas exogenous ORM2 supplementation protected against acinar cell injury and reduced pancreatic inflammation in both in vivo and in vitro models, highlighting its clinical translational value. We present this article in accordance with the ARRIVE reporting checklist (available at https://tgh.amegroups.com/article/view/10.21037/tgh-25-106/rc).

Methods

Animals and AP model

Eight-week-old C57BL/6J mice were purchased from Nanjing GemPharmatech Co., Ltd. (Nanjing, China). ORM1-deficient mice were generated as previously described (12). CRISPR/Cas9-mediated pancreas-specific ORM2 knockout was performed through pancreatic duct injection of AAV-SpCas9-ORM2-sgRNA. All mice used in this study were half male and half female. All animals were housed at 24 ℃ under a 12-h light-dark cycle. In our study, mice were randomly assigned to experimental groups using a computer-generated random number sequence, with blocking by weight and sex to ensure balanced distribution. The allocation sequence was concealed from the investigators until interventions were assigned. During all outcome assessments, including behavioral tests and histological analyses, investigators were blinded to group identities.

Mice model of AP was induced by repeated intraperitoneal injection of caerulein (13) (No. B8465, APExBio, Houston, USA). Briefy, eight-week-old mice were injected intraperitoneally with caerulein for 8 hours, at a dose of 50 µg/kg. Mice were sacrificed 12 hours after the first injection of caerulein. The ORM2 (No. HY-P7490, MedChemExpress, New Jersey, USA) treatment was divided into low-dose and high-dose groups. The low-dose group received intraperitoneal injections of ORM2 (50 µg/kg) at the 4th and 8th hours after caerulein injection, while the high-dose group received intraperitoneal injections of ORM2 (100 µg/kg) at the same time points. The control and AP groups were given an equivalent volume of saline. Experiments were performed under a project license [No. CHEC (A. E) 2025-044] granted by the ethics committee of the Changhai Hospital, in compliance with Chinese national or institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration.

Isolation of primary pancreatic acinar cells

Pancreatic acinar cells were isolated with collagenase digestion (14). Briefly, freshly harvested pancreatic tissue was minced in ice-cold calcium-free HBSS followed by enzymatic digestion in collagenase P (0.5 mg/mL), soybean trypsin inhibitor (0.25 mg/mL), and DNase I (0.1 mg/mL) at 37 ℃ for 30 min. The dissociated tissue was filtered through a 70-µm strainer, and further purified by gravity (2 min). The isolated acinar cells were then used for subsequent experiments.

Western blotting

Total protein extraction and immunoblotting were performed using standard protocols as previously described (15). Tissue samples or cultured cells were lysed in protein extraction reagent (No. KC-415, Kangchen, Shanghai, China) containing protease inhibitor cocktail (No. C0001, TargetMol, Shanghai, China). Following centrifugation at 12,000 g for 15 min, the supernatant was collected and protein concentration measured using an BCA assay kit (No. P0010, Beyotime, Shanghai, China). Proteins were separated on SurePage gels (No. M00654, GeneScript, Nanjing, China), transferred to PVDF membranes, and probed with appropriate primary and secondary antibodies. The antibodies used in this study are listed as follows: ORM1 (No. 16439-1-AP proteintech, Wuhan, China), ORM2 (No. P19652, zenbio, Chengdu, China), GAPDH (No. A19056, ABclonal, Wuhan, China), HRP-conjugated Goat anti-Rabbit IgG (H+L) (No. AS014, ABclonal, Wuhan, China).

Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR)

Total RNA was extracted using TRIzol reagent, followed by reverse transcription and RT-PCR according to established protocols (15). The primers sequence (5’-3’) used in this study are listed as follows: Orm1 (mouse, Forward)- CGAGTACAGGCAGGCAATTCA, Orm1 (mouse, Reverse)- ACCTATTGTTTGAGACTCCCGA; Orm2 (mouse, Forward)-CAACATCACCATAGGCGACCC, Orm2 (mouse, Reverse)-ATTTCCTGCCGGTAATCAGGG; Il-1β (mouse, Forward)-GCAACTGTTCCTGAACTCAACT, Il-1β (mouse, Reverse)-ATCTTTTGGGGTCCGTCAACT; Il-6 (mouse, Forward)-TAGTCCTTCCTACCCCAATTTCC, Il-6 (mouse, Reverse)-TTGGTCCTTAGCCACTCCTTC; Tnf-α (mouse, Forward)-CCCTCACACTCAGATCATCTTCT, Tnf-α (mouse, Reverse)- GCTACGACGTGGGCTACAG; F4/80 (mouse, Forward)- TCGGCTCCTTTCCTCACTCA, F4/80 (mouse, Reverse)- CTCATAGGGTTGTTCGCTCGG; Mpo (mouse, Forward)-AGTTGTGCTGAGCTGTATGGA, Mpo (mouse, Reverse)-CGGCTGCTTGAAGTAAAACAGG; Spink1 (mouse, Forward)-TTTGGCCCTGCTGAGTTTAGC, Spink1 (mouse, Reverse)-TGGCATAAGTAATTCCGTCAGTC; Prss2 (mouse, Forward)- TATCAGGTGTCCCTAAATGCTGG, Prss2 (mouse, Reverse)-GGATGCGGTATTTGTAGCAGT.

Serum amylase and lipase assay

The serum amylase and lipase levels were measured using commercial assay kits (No. E-BC-K006-M, and No. E-BC-K786-M, Elabscience, Wuhan, China) according to the manufacturer’s instructions.

Trypsin activity

Pancreatic trypsin activity was determined using a commercial trypsin activity kit (No. ab102531, Abcam, Cambridge, UK) following the manufacturer’s standardized procedures.

Serum ELISA

The concentrations of ORM, IL-6, and TNF-α in serum were measured using respective ELISA kits (No. ab264605, No. ab222503, No. ab208348, Abcam, Cambridge, UK) following the manufacturers’ instructions.

Tissue staining [hematoxylin and eosin (H&E) and immunohistochemistry (IHC)]

For histological analysis, paraffin-embedded tissue sections were processed using standard protocols. After deparaffinization and rehydration, sections were stained with H&E for morphological evaluation. For IHC, antigen retrieval was performed followed by endogenous peroxidase blocking with 3% H₂O₂. Sections were then incubated with 5% BSA for blocking, primary antibody (overnight at 4 ℃), and HRP-conjugated secondary antibody (1 h at room temperature). Finally, DAB substrate was applied for visualization, followed by hematoxylin counterstaining and mounting with neutral resin.

Proteomics and dataset assay

Tissue proteins were extracted, reduced, alkylated, and enzymatically digested. Peptides were desalted and analyzed by nanoLC-MS/MS (Vanquish neo UPLC coupled to Astral MS) with an 8 min gradient. DIA acquisition used 380–980 m/z (MS1) and 150–2,000 m/z (MS2) ranges. Data were processed using DIA-NN (UniProt mouse database, FDR ≤1%). Serum ORM1 and ORM2 from AP patients and healthy controls were assessed using a published dataset (GSE194331).

Statistical analysis

Data are shown as mean ± standard error of the mean. Statistical significance (P<0.05) was determined by one-way analysis of variance (ANOVA) and Tukey’s post-hoc testing for multiple comparisons (GraphPad Prism 10).

Results

Reduced pancreatic ORM2 expression in AP

As an acute-phase protein, ORM is known to significantly increase in serum during inflammatory conditions. Analysis of the public GSE194331 dataset revealed significantly elevated levels of both ORM1 and ORM2 in peripheral blood samples from mild acute pancreatitis (MAP) patients compared to healthy controls (Figure 1A,1B). Consistent with this, we observed elevated serum ORM levels in murine AP models (Figure 1C). Since mice express three ORM isoforms (ORM1, ORM2, and ORM3, with ORM1 and ORM2 being predominant) (16), we further analyzed these subtypes by immunoblotting. Both ORM1 and ORM2 were markedly upregulated in the serum from mouse model of AP (Figure 1D). Since the liver serves as the principal organ for ORM synthesis, we examined ORM expression in the liver and pancreas to investigate the origin of this increase. Consistent with the serum increases, we observed elevated ORM1 and ORM2 levels in the liver during AP (Figure 1E). Strikingly, however, pancreatic tissue exhibited the opposite pattern: both isoforms were downregulated in AP mice compared to controls (Figure 1F). This organ-specific dysregulation suggests that ORM may play a distinct role in pancreatic inflammation pathogenesis, warranting further investigation.

Figure 1 Reduced pancreatic ORM2 expression in AP. (A) Scatterplots showing log2 transformation of the normalized blood ORM1 in patients with MAP (n=57) and healthy controls (n=32). (B) Scatterplots showing log2 transformation of the normalized blood ORM2 in patients with MAP (n=57) and healthy controls (n=32). (C) The serum ORM in control and AP mice (n=6 per group). (D) Immunoblotting of ORM1 and ORM2 in serum from control and AP mice (n=6 per group). (E) Immunoblotting and quantitative analysis of ORM1 and ORM2 in pancreas from control and AP mice (n=6 per group). (F) Immunoblotting and quantitative analysis of ORM1 and ORM2 in liver from control and AP mice (n=6 per group). Data are presented as mean ± SEM. The groups were compared using unpaired two-tailed student’s t-test (*, P<0.05; ***, P<0.001; ****, P<0.0001). AP, acute pancreatitis; MAP, mild acute pancreatitis; ORM, orosomucoid; SEM, standard error of the mean.

ORM2 deficiency, but not ORM1, contribute to AP progression

To investigate the respective roles of ORM1 and ORM2 in the pathogenesis of AP, we generated ORM1 and ORM2 knockout mice separately and induced AP models. We found that serum amylase and inflammatory cytokines (IL-6, TNF-α) were significantly elevated in AP mice, while systemic ORM1 knockout did not affect these changes (Figure S1A-S1C). Furthermore, pancreatic H&E staining demonstrated comparable levels of edema, necrosis, and inflammatory infiltration in both ORM1^+/+ and ORM^-/- mice after AP induction, with no significant differences observed (Figure S1D). We then investigated the effects of ORM2. Using AAV-mediated pancreatic duct injection to develop pancreas-specific ORM2 knockout mice, we found that conditional ORM2 knockout further exacerbated the cerulein-induced increases in serum amylase and inflammatory cytokines (Figure 2A-2C), as well as worsened pancreatic histopathological scores (Figure 2D). These experiments demonstrate that ORM2 deficiency, but not ORM1, promotes the progression of AP.

Figure 2 ORM2 deficiency contributes to AP progression. (A) The serum amylase level from ORM2^WT and ORM2^KO mice subjected to intraperitoneal injection of vehicle or caerulein (n=6 per group). (B) The serum IL-6 from ORM2^WT and ORM2^KO mice subjected to intraperitoneal injection of vehicle or caerulein (n=6 per group). (C) The serum TNF-α from ORM2^WT and ORM2^KO mice subjected to intraperitoneal injection of vehicle or caerulein (n=6 per group). (D) Representative HE staining and histological scores of the pancreatic tissues in ORM2^WT and ORM2^KO mice subjected to intraperitoneal injection of vehicle or caerulein (n=6 per group). Scale bar: 50 µm. Data are presented as mean ± SEM. The groups were compared using one-way ANOVA with Tukey’s post hoc test (****, P<0.0001). ANOVA, analysis of variance; AP, acute pancreatitis; IL-6, interleukin-6; HE, hematoxylin and eosin; SEM, standard error of the mean; TNF-α, tumor necrosis factor-alpha.

Exogenous ORM2 attenuates acinar cell injury in vitro

Acinar cell injury is a hallmark pathological change in AP (17). We therefore examined ORM2’s protective effects using isolated primary pancreatic acinar cells in vitro. When treated with cholecystokinin (CCK, 10 nM), the primary acinar cells exhibited inflammatory responses, including elevated levels of inflammatory cytokines (IL-1β, IL-6, TNF-α) and increased amylase secretion. Notably, exogenous treatment with ORM2 demonstrated a dose-dependent protective effect by significantly suppressing these inflammatory phenotypes, thereby protecting acinar cells from CCK-induced injury (Figure 3A-3D). These in vitro results demonstrate ORM2’s potential as a therapeutic agent for AP.

Figure 3 Exogenous ORM2 attenuates acinar cell injury in vitro. (A) The mRNA level of Il-1β in control and CCK-induced primary acinar cells following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). Low-dose ORM2: 5 µg/mL, high-dose ORM2: 10 µg/mL. (B) The mRNA level of Il-6 in control and CCK-induced primary acinar cells following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (C) The mRNA level of Tnf-α in control and CCK-induced primary acinar cells following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (D) The amylase level in control and CCK-induced primary acinar cells following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). Data are presented as mean ± SEM. The groups were compared using one-way ANOVA with Tukey’s post hoc test (ns, not significant; **, P<0.01; ****, P<0.0001). ANOVA, analysis of variance; CCK, cholecystokinin; SEM, standard error of the mean.

Recombinant ORM2 administration alleviates AP in vivo

To further investigate the protective role of ORM2 in AP, we generated cerulein-induced mouse model of AP and administered exogenous ORM2 to elevate its pancreatic levels. Following eight consecutive cerulein injections, mice developed characteristic AP phenotypes including increased pancreatic expression of inflammatory cytokines such as IL-1β, IL-6 and TNF-α (Figure 4A), elevated serum amylase and lipase levels (Figure 4B), histopathological evidence of edema and necrosis with inflammatory infiltration as shown by H&E staining (Figure 4C), and enhanced macrophage and neutrophil infiltration demonstrated by both RT-PCR and IHC analysis (Figure 4D). Notably, exogenous ORM2 administration dose-dependently attenuated these AP-associated inflammatory features (Figure 4A-4D). These in vivo results validate the potent anti-inflammatory effects of ORM2 in AP.

Figure 4 Recombinant ORM2 administration alleviates AP in vivo. (A) The mRNA levels of Il-1β, Il-6, Tnf-α, F4/80, Mpo in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (B) The serum amylase and lipase in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (C) Representative HE staining and histological scores of the pancreatic tissues in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). Scale bar: 50 µm. (D) Representative immunohistochemical staining of the pancreatic tissues in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). Scale bar: 50 µm. The groups were compared using one-way ANOVA with Tukey’s post hoc test (ns, not significant; **, P<0.01; ***, P<0.001; ****, P<0.0001). ANOVA, analysis of variance; AP, acute pancreatitis; OH, high-dose ORM2; OL, low-dose ORM2; MPO, myeloperoxidase.

ORM2 inhibits pancreatic inflammation by preventing premature trypsinogen activation

To investigate the mechanism by which ORM2 alleviates acinar cell injury in AP, we conducted proteomic analysis. The results revealed significantly differential expression in pancreatic protein profiles: compared with control mice, the AP group showed 529 upregulated and 1,198 downregulated proteins, while the ORM2-treated group exhibited 143 upregulated and 87 downregulated proteins relative to the AP group. Notably, the AP group demonstrated marked elevation of pro-inflammatory proteins (e.g., MPO, S100A8, S100A9), consistent with previous research (18,19). Premature trypsin activation drives acinar injury in AP, where functional loss mutations of Spink1 and functional gain mutations of Prss2 are known genetic risks (20,21). We observed corresponding molecular changes: depressed SPINK1 and elevated PRSS2 expression in AP mice (Figure 5A). ORM2 treatment reversed these changes, normalizing their expression levels (Figure 5B-5D). This suggests ORM2 may protect against acinar injury by rebalancing the SPINK1-PRSS2 axis to prevent premature trypsin activation. Supporting this hypothesis, we observed that ORM2 significantly suppressed trypsin activity in pancreatic tissues of AP mice (Figure 5E).

Figure 5 ORM2 inhibits pancreatic inflammation by preventing premature trypsinogen activation. (A) Volcano plot of differentially expressed proteins between AP and control groups. (B) Volcano plot of differentially expressed proteins between AP + ORM2 and AP groups (ORM2, 100 µg/kg). (C) The mRNA levels of Spink1 in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (D) The mRNA levels of Prss2 in control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). (E) The trypsin activity in pancreatic tissues from control and AP mice following treatment with vehicle, low-dose ORM2, or high-dose ORM2 (n=6 per group). Data are presented as mean ± SEM. The groups were compared using one-way ANOVA with Tukey’s post hoc test (ns, not significant; *, P<0.05; **, P<0.01; ****, P<0.0001). ANOVA, analysis of variance; AP, acute pancreatitis; OH, high-dose ORM2; OL, low-dose ORM2; SEM, standard error of the mean.

Discussion

The successful resolution of AP hinges on a precisely regulated tissue regeneration, whereas incomplete repair leads to exocrine dysfunction and chronic pancreatitis development (22,23). This reparative process critically depends on the balance between pro-inflammatory and anti-inflammatory microenvironments. While the immunomodulatory functions of ORM have been previously discovered in both hepatic and extrahepatic contexts, our study provides novel evidence for its anti-inflammatory role in pancreatic injury repair.

By analyzing the public dataset GSE194331 from patients with AP and healthy individuals, we observed that both ORM1 and ORM2 levels were significantly elevated in the serum of AP patients. Furthermore, analysis of serum samples from normal and AP mice also revealed increased ORM levels in the murine model of AP. The concordance of findings across human and mouse samples highlights the translational value of elevated ORM as a promising new biomarker for AP diagnosis. Our study revealed elevated ORM expression in liver but decreased levels in pancreas following AP, demonstrating distinct tissue-specific expression patterns. We hypothesize that during pancreatitis, the pro-inflammatory microenvironment in pancreatic tissue may downregulate protective ORM expression. Given that the liver serves as the primary site for ORM production and secretion, an intriguing possibility is that hepatic tissue-derived ORM might be transported to inflamed pancreatic tissue to facilitate repair. This potential liver-pancreas crosstalk could represent a novel mechanistic axis in pancreatic recovery. Moreover, our study revealed that while both ORM1 and ORM2 showed similar expression patterns in liver and pancreas during pancreatitis, only ORM2 exhibited protective effects, demonstrating distinct isoform-specific functions. In humans, ORM exists as two isoforms (ORM1 and ORM2), mice express three (ORM1, ORM2 and ORM3), while rats have only a single isoform (4). Notably, ORM2 can exert either anti-inflammatory or pro-inflammatory effects depending on the tissue and cellular context - it reduces hepatic steatosis, inflammation, and fibrosis in the liver (8), yet enhances pro-inflammatory cytokine production in synovial membranes, promoting chronic arthritis (10). Our findings provide further evidence for ORM2’s anti-inflammatory properties through its protective role in AP.

The self-digestion of pancreatic tissue caused by premature activation of pancreatic enzymes serves as a critical mechanism underlying acinar cell injury in AP (24-26). Under physiological conditions, pancreatic tissues maintain a balance between trypsin activation and degradation, which becomes disrupted during AP. Current evidence demonstrates that various genetic mutations—including cationic trypsinogen gene (Spink1, functional loss mutations) and serine protease inhibitor kazal type 2 (Prss2, functional gain mutations)—play important roles in regulating pancreatic exocrine function and inflammatory responses during pancreatic injury (27-30). Our study demonstrates that ORM restores the critical homeostasis of trypsin activation and degradation in AP by normalizing SPINK1 and PRSS2 expression, thereby promoting acinar cell recovery.

Conclusions

In summary, our findings demonstrate a critical protective role for ORM2 in AP. We identified a tissue-specific dysregulation of ORM during AP, characterized by decreased pancreatic ORM2 levels despite systemic and hepatic increases. Genetic deletion of pancreatic ORM2 exacerbated AP severity, whereas exogenous ORM2 administration provided significant protection against pancreatic injury both in vitro and in vivo. Mechanistically, ORM2 modulates the SPINK1-PRSS2 axis to inhibit premature trypsin activation, a key driver of acinar cell injury in AP. These results not only elucidate a novel, isoform-specific function for ORM2 in pancreatic inflammation and repair but also highlight its potential as a therapeutic agent for AP.

Acknowledgments

None.

Footnote

Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://tgh.amegroups.com/article/view/10.21037/tgh-25-106/rc

Data Sharing Statement: Available at https://tgh.amegroups.com/article/view/10.21037/tgh-25-106/dss

Peer Review File: Available at https://tgh.amegroups.com/article/view/10.21037/tgh-25-106/prf

Funding: This study was supported by grants from the National Natural Science Foundation of China (No. 82104257 to P.W., No. 82270679 to L.H.), Hebei Natural Science Foundation (No. H2025101001 to P.W.).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tgh.amegroups.com/article/view/10.21037/tgh-25-106/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Experiments were performed under a project license [No. CHEC (A. E) 2025-044] granted by the ethics committee of the Changhai Hospital, in compliance with Chinese national or institutional guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Trikudanathan G, Yazici C, Evans Phillips A, et al. Diagnosis and Management of Acute Pancreatitis. Gastroenterology 2024;167:673-88. [Crossref] [PubMed]
2. Jiang J, Wang R, Song P, et al. Lactate Facilitates Pancreatic Repair Following Acute Pancreatitis by Promoting Reparative Macrophage Polarization. Cell Mol Gastroenterol Hepatol 2025;19:101535. [Crossref] [PubMed]
3. Zhang T, Chen S, Li L, et al. PFKFB3 controls acinar IP3R-mediated Ca2+ overload to regulate acute pancreatitis severity. JCI Insight 2024;9:e169481. [Crossref] [PubMed]
4. Luo Z, Lei H, Sun Y, et al. Orosomucoid, an acute response protein with multiple modulating activities. J Physiol Biochem 2015;71:329-40. [Crossref] [PubMed]
5. Wang PY, Feng JY, Zhang Z, et al. The adipokine orosomucoid alleviates adipose tissue fibrosis via the AMPK pathway. Acta Pharmacol Sin 2022;43:367-75. [Crossref] [PubMed]
6. Jo M, Kim JH, Song GJ, et al. Astrocytic Orosomucoid-2 Modulates Microglial Activation and Neuroinflammation. J Neurosci 2017;37:2878-94. [Crossref] [PubMed]
7. Jing K, Gu R, Chen F, et al. Orosomucoid 2 is an endogenous regulator of neuronal mitochondrial biogenesis and promotes functional recovery post-stroke. Pharmacol Res 2024;209:107422. [Crossref] [PubMed]
8. Zhou B, Luo Y, Ji N, et al. Orosomucoid 2 maintains hepatic lipid homeostasis through suppression of de novo lipogenesis. Nat Metab 2022;4:1185-201. [Crossref] [PubMed]
9. Li L, Sun H, Chen J, et al. Mitigation of non-alcoholic steatohepatitis via recombinant Orosomucoid 2, an acute phase protein modulating the Erk1/2-PPARγ-Cd36 pathway. Cell Rep 2023;42:112697. [Crossref] [PubMed]
10. Kim KM, Lee KG, Lee S, et al. The acute phase reactant orosomucoid-2 directly promotes rheumatoid inflammation. Exp Mol Med 2024;56:890-903. [Crossref] [PubMed]
11. Lee YS, Choi JW, Hwang I, et al. Adipocytokine orosomucoid integrates inflammatory and metabolic signals to preserve energy homeostasis by resolving immoderate inflammation. J Biol Chem 2010;285:22174-85. [Crossref] [PubMed]
12. Lei H, Sun Y, Luo Z, et al. Fatigue-induced Orosomucoid 1 Acts on C-C Chemokine Receptor Type 5 to Enhance Muscle Endurance. Sci Rep 2016;6:18839. [Crossref] [PubMed]
13. An Y, Tu Z, Wang A, et al. Qingyi decoction and its active ingredients ameliorate acute pancreatitis by regulating acinar cells and macrophages via NF-κB/NLRP3/Caspase-1 pathways. Phytomedicine 2025;139:156424. [Crossref] [PubMed]
14. Choi J, Oh TG, Jung HW, et al. Estrogen-Related Receptor γ Maintains Pancreatic Acinar Cell Function and Identity by Regulating Cellular Metabolism. Gastroenterology 2022;163:239-56. [Crossref] [PubMed]
15. Wang P, Huang B, Liu Y, et al. Corynoline protects chronic pancreatitis via binding to PSMA2 and alleviating pancreatic fibrosis. J Gastroenterol 2024;59:1037-51. [Crossref] [PubMed]
16. Fournier T, Medjoubi-N N, Porquet D. Alpha-1-acid glycoprotein. Biochim Biophys Acta 2000;1482:157-71. [Crossref] [PubMed]
17. Aney KJ, Jeong WJ, Vallejo AF, et al. Novel Approach for Pancreas Transcriptomics Reveals the Cellular Landscape in Homeostasis and Acute Pancreatitis. Gastroenterology 2024;166:1100-13. [Crossref] [PubMed]
18. Li H, Zhao L, Wang Y, et al. Roles, detection, and visualization of neutrophil extracellular traps in acute pancreatitis. Front Immunol 2022;13:974821. [Crossref] [PubMed]
19. Mo S, Wu W, Luo K, et al. Identification and analysis of chemokine-related and NETosis-related genes in acute pancreatitis to develop a predictive model. Front Genet 2024;15:1389936. [Crossref] [PubMed]
20. Morales Granda NC, Toldi V, Miczi M, et al. Inhibition of mouse trypsin isoforms by SPINK1 and effect of human pancreatitis-associated mutations. Pancreatology 2023;23:358-66. [Crossref] [PubMed]
21. Wang J, Wan J, Wang L, et al. Wild-Type Human PRSS2 and PRSS1(R122H) Cooperatively Initiate Spontaneous Hereditary Pancreatitis in Transgenic Mice. Gastroenterology 2022;163:313-315.e4. [Crossref] [PubMed]
22. Strum WB, Boland CR. Advances in acute and chronic pancreatitis. World J Gastroenterol 2023;29:1194-201. [Crossref] [PubMed]
23. Bouça-Machado T, Bouwense SAW, Brand M, et al. Position statement on the definition, incidence, diagnosis and outcome of acute on chronic pancreatitis. Pancreatology 2023;23:143-50. [Crossref] [PubMed]
24. Liu X, Zheng Y, Meng Z, et al. Gene Regulation of Neutrophils Mediated Liver and Lung Injury through NETosis in Acute Pancreatitis. Inflammation 2025;48:393-411. [Crossref] [PubMed]
25. Thiel FG, Asgarbeik S, Glaubitz J, et al. IRAK3-mediated suppression of pro-inflammatory MyD88/IRAK signaling affects disease severity in acute pancreatitis. Sci Rep 2023;13:10833. [Crossref] [PubMed]
26. Hu Z, Wang D, Gong J, et al. MSCs Deliver Hypoxia-Treated Mitochondria Reprogramming Acinar Metabolism to Alleviate Severe Acute Pancreatitis Injury. Adv Sci (Weinh) 2023;10:e2207691. [Crossref] [PubMed]
27. Zou WB, Tang XY, Zhou DZ, et al. SPINK1, PRSS1, CTRC, and CFTR Genotypes Influence Disease Onset and Clinical Outcomes in Chronic Pancreatitis. Clin Transl Gastroenterol 2018;9:204. [Crossref] [PubMed]
28. Pelaez-Luna M, Robles-Diaz G, Canizales-Quinteros S, et al. PRSS1 and SPINK1 mutations in idiopathic chronic and recurrent acute pancreatitis. World J Gastroenterol 2014;20:11788-92. [Crossref] [PubMed]
29. Zou WB, Cooper DN, Masson E, et al. Trypsinogen (PRSS1 and PRSS2) gene dosage correlates with pancreatitis risk across genetic and transgenic studies: a systematic review and re-analysis. Hum Genet 2022;141:1327-38. [Crossref] [PubMed]
30. Bourgault J, Abner E, Manikpurage HD, et al. Proteome-Wide Mendelian Randomization Identifies Causal Links Between Blood Proteins and Acute Pancreatitis. Gastroenterology 2023;164:953-965.e3. [Crossref] [PubMed]